DDD Research Variants
Variants of unknown significance in 4293 children with developmental disorders in the UK DDD study (www.ddduk.org). Variants have been identified from high quality calls from exome sequencing data (most have not been validated) and include functional de novo variants and rare loss-of-function homozygous, compound heterozygous and hemizygous variants in genes that are neither developmental disorder genes or OMIM-morbid genes in children who remain undiagnosed in the DDD study.
High-level phenotype terms are provided for each patient, and further details can be obtained by contacting DECIPHER directly (decipher@sanger.ac.uk). Diagnostic variants from the DDD study are in the standard DECIPHER Sequence Variant and Copy-Number Variant tracks linked to individual patients.
| Location | Gene | Allele | Consequence | Inheritance | Genotype | Phenotypes | Contact |
|---|---|---|---|---|---|---|---|
| VEZF1 | AG/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
2:128750773-128750773
|
SAP130 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:78560637-78560637
|
GIPC2 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
3:12977945-12977945
|
IQSEC1 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
19:35500816-35500816
|
GRAMD1A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
1:46495845-46495845
|
MAST2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
| FOSL2 | GC/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
||
|
19:50265271-50265271
|
TSKS | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the breast, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
16:24887052-24887052
|
SLC5A11 | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
10:126662892-126662892
|
ZRANB1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:98109538-98109538
|
OPALIN | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
1:89270569-89270569
|
PKN2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
15:64966774-64966774
|
ZNF609 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
X:104463811-104463812
|
TEX13A | CT/C | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of the nervous system | |
|
X:104463811-104463812
|
TEX13A | CT/C | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of the nervous system | |
|
2:170489746-170489746
|
PPIG | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:165649827-165649827
|
ALDH9A1 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
|
12:43770459-43770459
|
ADAMTS20 | G/GT | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
|
16:28884855-28884855
|
SH2B1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
7:44282257-44282257
|
CAMK2B | C/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
| MRPL41 | A/AC | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
||
|
3:189681746-189681746
|
LEPREL1 | C/T | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
17:27005584-27005584
|
SUPT6H | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
3:23930720-23930720
|
UBE2E1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:142967383-142967383
|
UBE2NL | G/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
17:65909197-65909197
|
BPTF | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
21:33044498-33044498
|
SCAF4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality, Neoplasm |
|
|
1:160794025-160794025
|
LY9 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality, Neoplasm |
|
|
6:26157043-26157043
|
HIST1H1E | C/CG | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:105473053-105473053
|
POU3F3 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Neoplasm |
|
| TIAM1 | C/CACCT | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Abnormality of the respiratory system |
||
| INPP5F | AGAG/A | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
17:38142858-38142858
|
PSMD3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the immune system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
4:90830554-90830554
|
MMRN1 | A/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
17:15995345-15995345
|
NCOR1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:129246087-129246087
|
BARX2 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:48183259-48183259
|
GLTSCR1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:55978830-55978830
|
OR8J2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
1:117064570-117064570
|
CD58 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:15306138-15306138
|
ASB11 | G/A | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of the nervous system | |
|
19:41086756-41086756
|
SHKBP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
6:28543860-28543860
|
SCAND3 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
18:74091434-74091434
|
ZNF516 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
4:40438616-40438616
|
RBM47 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the nervous system |
|
| FNDC7 | AATG/A | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the skeletal system |
||
|
8:30643756-30643759
|
PPP2CB | GGAA/G | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:120054210-120054210
|
HSD3B1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Growth abnormality |
|
|
X:106466065-106466065
|
PIH1D3 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument |
|
|
8:22675247-22675247
|
PEBP4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
2:218953991-218953991
|
RUFY4 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
16:22320792-22320792
|
POLR3E | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:55650813-55650814
|
FOXR2 | AC/A | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
7:80374231-80374231
|
SEMA3C | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
6:138745228-138745228
|
NHSL1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
10:135202549-135202549
|
PAOX | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:2223997-2223997
|
TRAF7 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the musculature |
|
|
10:116037780-116037780
|
VWA2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system, Neoplasm |
|
|
13:113728852-113728852
|
MCF2L | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:91083440-91083440
|
SPIN1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
6:10634797-10634797
|
GCNT6 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
11:831273-831273
|
EFCAB4A | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Growth abnormality |
|
|
18:12449803-12449803
|
SPIRE1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
14:64989628-64989628
|
ZBTB1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:57442097-57442097
|
MYO1A | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
14:77709263-77709263
|
TMEM63C | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:85838904-85838904
|
C2orf68 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:109691337-109691338
|
ZNF462 | AC/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:49506565-49506565
|
RUVBL2 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
4:125591766-125591766
|
ANKRD50 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:100275696-100275696
|
TMEM45A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
12:26377286-26377286
|
SSPN | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
X:140983281-140983283
|
MAGEC3 | CCA/C | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
20:37277327-37277327
|
ARHGAP40 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
10:99052336-99052336
|
ARHGAP19 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
X:57021329-57021329
|
SPIN3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:27121488-27121488
|
DPYSL5 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:30937218-30937218
|
FBXL19 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:53116998-53116998
|
TSPYL2 | T/G | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
15:65884011-65884011
|
VWA9 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system |
|
|
9:128113102-128113102
|
GAPVD1 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system |
|
|
6:34508815-34508815
|
SPDEF | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system |
|
| RLF | G/GAAAA | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system |
||
|
16:88947694-88947694
|
CBFA2T3 | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
11:6623422-6623422
|
RRP8 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
12:59274606-59274606
|
LRIG3 | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:49448180-49448180
|
DHDH | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
19:19030151-19030151
|
COPE | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the skeletal system, Growth abnormality |
|
|
2:135308217-135308217
|
TMEM163 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the skeletal system, Growth abnormality |
|
|
19:48006665-48006665
|
NAPA | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:132481618-132481618
|
PRRX2 | T/TCGAG | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:137848452-137848452
|
ETF1 | C/T | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:227381633-227381633
|
CDC42BPA | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:125831632-125831632
|
ALDH1L1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:118264282-118264282
|
DTWD2 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:57581487-57581487
|
CTSZ | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the skeletal system |
|
|
2:161137833-161137833
|
RBMS1 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the skeletal system |
|
|
2:27121488-27121488
|
DPYSL5 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:122522801-122522801
|
TSN | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
|
|
4:25253982-25253982
|
PI4K2B | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
| SON | C/CT | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
||
|
20:52558069-52558069
|
BCAS1 | A/C | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:135801165-135801165
|
PPP2R3A | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the breast, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:1584630-1584630
|
MBD3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument |
|
|
13:30351370-30351370
|
UBL3 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument |
|
|
2:171248925-171248925
|
MYO3B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the musculature, Abnormality of the nervous system |
|
|
4:74014541-74014541
|
ANKRD17 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
21:40569125-40569125
|
BRWD1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
16:2223990-2223990
|
TRAF7 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
12:117595691-117595691
|
FBXO21 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the nervous system |
|
| EIF4G2 | A/AGT | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the nervous system |
||
|
13:26923295-26923295
|
CDK8 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:27107209-27107209
|
HIST1H4I | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument |
|
|
2:33817146-33817146
|
FAM98A | C/A | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument |
|
|
10:3167371-3167371
|
PFKP | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:69158644-69158644
|
SLC35E3 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:130799416-130799416
|
NEK11 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system |
|
|
19:58059287-58059287
|
ZNF550 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
14:105834449-105834449
|
PACS2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:5686526-5686526
|
TRIM5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
17:56060217-56060217
|
VEZF1 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:115109265-115109265
|
CADM1 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the skeletal system |
|
|
12:80222146-80222146
|
PPP1R12A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:38893319-38893320
|
GALM | AG/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
11:3687683-3687683
|
CHRNA10 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
|
19:42133262-42133262
|
CEACAM4 | C/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
|
17:48734399-48734399
|
ABCC3 | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:152487933-152487933
|
CRCT1 | C/CCGCCCCGGCGCCCACCCCGG | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:139903856-139903856
|
ABCA2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
19:11456031-11456031
|
TMEM205 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
|
17:7806037-7806037
|
CHD3 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
|
11:10774217-10774217
|
CTR9 | A/C | Likely LOF (splice acceptor variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
16:11857495-11857495
|
ZC3H7A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
11:119206698-119206698
|
RNF26 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
10:530768-530768
|
DIP2C | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
12:6669354-6669354
|
NOP2 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the respiratory system |
|
| LRIG1 | TAAC/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the skeletal system, Growth abnormality |
||
|
6:159672555-159672555
|
FNDC1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the skeletal system, Growth abnormality |
|
|
2:219140313-219140313
|
TMBIM1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
2:29016735-29016735
|
PPP1CB | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system, Growth abnormality |
|
|
19:21301008-21301008
|
ZNF714 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
19:1036542-1036542
|
CNN2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:34240646-34240646
|
RBM12 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
11:95516390-95516390
|
FAM76B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
4:134073108-134073108
|
PCDH10 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
11:5699591-5699591
|
TRIM5 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
15:65456511-65456511
|
CLPX | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:47374777-47374777
|
KLHL18 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:79576321-79576321
|
DLG5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the endocrine system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:76503456-76503456
|
DNAH17 | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:46190703-46190703
|
SNX11 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:49336010-49336010
|
HSD17B14 | C/G | Likely LOF (splice acceptor variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:1158062-1158062
|
MUC5AC | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
22:20940056-20940056
|
MED15 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
11:46407071-46407071
|
CHRM4 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
2:135180458-135180458
|
MGAT5 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:14027118-14027118
|
GEMIN8 | T/TTCTGTATGACATCTAAGCTCTGTA | Likely LOF (stop gained) |
De novo constitutive | Hemizygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
2:242039038-242039038
|
MTERFD2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:53115010-53115010
|
TSPYL2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
18:43572096-43572096
|
PSTPIP2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| DDX60L | TG/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
||
| RNFT2 | A/AAGGG | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Growth abnormality |
||
| KCNC4 | T/TC | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Growth abnormality |
||
|
2:43451899-43451925
|
ZFP36L2 | GGCCCCCGGCGCCAGCAGGTCCTCGGC/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Growth abnormality |
|
|
22:29957172-29957172
|
NIPSNAP1 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
3:192053223-192053223
|
FGF12 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
6:44102451-44102451
|
TMEM63B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the ear, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
7:45009399-45009399
|
MYO1G | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the immune system, Abnormality of the integument |
|
|
5:139909363-139909363
|
ANKHD1-EIF4EBP3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology | |
|
19:1527982-1527982
|
PLK5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the breast, Abnormality of the integument, Abnormality of the nervous system |
|
|
15:38808490-38808490
|
RASGRP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the breast, Abnormality of the integument, Abnormality of the nervous system |
|
|
7:94903256-94903256
|
PPP1R9A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the breast, Abnormality of the integument, Abnormality of the nervous system |
|
|
1:173839494-173839494
|
ZBTB37 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the breast, Abnormality of the integument, Abnormality of the nervous system |
|
|
14:64153202-64153202
|
SGPP1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
1:33745934-33745934
|
ZNF362 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
1:36359409-36359409
|
AGO1 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the nervous system |
|
|
X:71427544-71427544
|
ERCC6L | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
2:135988379-135988379
|
ZRANB3 | G/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
2:206921225-206921227
|
INO80D | GTT/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:58115759-58115760
|
ZNF530 | GT/G | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
9:37777620-37777620
|
TRMT10B | C/A | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
4:36126591-36126591
|
ARAP2 | T/A | Likely LOF (splice acceptor variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
22:23465544-23465544
|
GNAZ | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
6:43173912-43173912
|
CUL9 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:158621832-158621832
|
RNF145 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:1464855-1464855
|
BRSK2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
|
|
1:33234379-33234396
|
KIAA1522 | GGATTCATGGGCAGGGGA/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
20:32377326-32377326
|
ZNF341 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice, Growth abnormality |
|
| SLC35F5 | GT/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice, Growth abnormality |
||
|
1:248224776-248224776
|
OR2L3 | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice, Growth abnormality |
|
|
7:57528844-57528845
|
ZNF716 | CA/C | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:89956076-89956076
|
CHORDC1 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
3:173525475-173525475
|
NLGN1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
16:15730009-15730009
|
KIAA0430 | G/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
9:37746434-37746434
|
FRMPD1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear |
|
|
21:46067225-46067225
|
KRTAP10-11 | C/CG | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Neoplasm |
|
|
14:24885633-24885633
|
NYNRIN | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the breast, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:109546416-109546416
|
RPL34 | A/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of metabolism/homeostasis, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
15:37376088-37376088
|
MEIS2 | T/C | Likely LOF (splice acceptor variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:14043651-14043651
|
PODNL1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
10:126631792-126631792
|
ZRANB1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
11:66053228-66053228
|
YIF1A | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the skeletal system |
|
|
12:50492587-50492587
|
SMARCD1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
11:55761693-55761693
|
OR5F1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
11:123886946-123886946
|
OR10G4 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system |
|
|
8:110394735-110394735
|
PKHD1L1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system |
|
|
16:66783106-66783106
|
DYNC1LI2 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system |
|
|
17:80544011-80544011
|
FOXK2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
| TRAK1 | CAGTA/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
||
|
16:58555172-58555172
|
CNOT1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:990886-990886
|
DMRT3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:131300452-131300452
|
CPNE4 | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:232321342-232321342
|
NCL | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
11:103908677-103908677
|
DDI1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
19:6456534-6456534
|
SLC25A23 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the nervous system |
|
|
7:105909701-105909701
|
NAMPT | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:85397173-85397173
|
CCDC89 | T/A | Protein Changing (initiator codon variant) |
De novo constitutive | Heterozygous | Abnormality of the integument, Abnormality of the nervous system |
|
|
17:74084968-74084968
|
EXOC7 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
5:114620509-114620509
|
CCDC112 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
1:152130281-152130281
|
RPTN | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
19:56172517-56172517
|
U2AF2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
15:68119340-68119340
|
SKOR1 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
4:17528485-17528485
|
CLRN2 | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
7:45009309-45009309
|
MYO1G | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the skeletal system |
|
|
19:14000692-14000692
|
C19orf57 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of blood and blood-forming tissues, Abnormality of the ear, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
7:48312799-48312799
|
ABCA13 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:129173111-129173111
|
BCORL1 | G/T | Likely LOF (splice acceptor variant) |
De novo constitutive | Hemizygous | Abnormality of abdomen morphology, Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:407794-407794
|
CHL1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the breast, Abnormality of the ear, Abnormality of the nervous system |
|
|
2:74328470-74328470
|
TET3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the breast, Abnormality of the ear, Abnormality of the nervous system |
|
|
12:4721720-4721720
|
DYRK4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the breast, Abnormality of the ear, Abnormality of the nervous system |
|
|
19:52090836-52090836
|
ZNF175 | C/T | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of the breast, Abnormality of the ear, Abnormality of the nervous system |
|
|
17:73805947-73805947
|
UNK | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system |
|
|
22:43623383-43623383
|
SCUBE1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
6:127796845-127796845
|
SOGA3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:156812858-156812858
|
INSRR | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
17:64738805-64738805
|
PRKCA | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
5:64976535-64976535
|
SGTB | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the musculature, Abnormality of the skeletal system |
|
|
1:201816449-201816449
|
IPO9 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the musculature, Abnormality of the skeletal system |
|
|
1:10132189-10132189
|
UBE4B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
X:15768282-15768282
|
CA5B | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
10:103868839-103868840
|
LDB1 | TG/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
14:91931692-91931692
|
SMEK1 | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| HIVEP2 | TC/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
17:80007662-80007662
|
RFNG | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:54635689-54635689
|
CBX5 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
17:57647918-57647918
|
DHX40 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
5:137427116-137427116
|
WNT8A | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
20:60893618-60893618
|
LAMA5 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
17:42290219-42290219
|
UBTF | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
9:88938530-88938530
|
ZCCHC6 | A/C | Protein Changing (initiator codon variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
19:47424630-47424630
|
ARHGAP35 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:175046825-175046825
|
TNN | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
7:137607344-137607346
|
CREB3L2 | AAC/A | Likely LOF (frameshift variant) |
Paternally inherited, constitutive in father | Compound heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
7:137569632-137569632
|
CREB3L2 | C/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Compound heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
15:41192208-41192208
|
VPS18 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:57325806-57325806
|
PEG3 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:52467445-52467445
|
C12orf44 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:78676546-78676546
|
ROBO1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:96117248-96117250
|
CCDC82 | CCA/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
3:135870774-135870774
|
MSL2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
3:78666808-78666808
|
ROBO1 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
2:220250352-220250352
|
DNPEP | C/A | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:64967030-64967030
|
JMJD1C | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
18:32825642-32825648
|
ZNF397 | AGGTCCT/A | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of the nervous system, Growth abnormality |
|
|
19:2243509-2243509
|
SF3A2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the endocrine system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
15:41819766-41819766
|
RPAP1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
X:54836213-54836213
|
MAGED2 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument |
|
|
12:111786041-111786041
|
CUX2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
17:57754422-57754422
|
CLTC | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:24580172-24580172
|
RBBP6 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:22390766-22390766
|
GPR125 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Growth abnormality | |
|
20:61512815-61512815
|
DIDO1 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Growth abnormality | |
|
2:27478190-27478190
|
SLC30A3 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Growth abnormality | |
|
16:58633145-58633145
|
CNOT1 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
14:100820157-100820157
|
WARS | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:160761761-160761761
|
GABRB2 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
19:2936616-2936616
|
ZNF77 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
13:103510661-103510661
|
BIVM-ERCC5 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
8:3611464-3611464
|
CSMD1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| BHLHE40 | CA/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
17:60663539-60663539
|
TLK2 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:2410013-2410013
|
PLCH2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
11:56380662-56380662
|
OR5M1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:5152980-5152980
|
OR52A5 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
6:101075504-101075504
|
ASCC3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the breast, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice, Growth abnormality |
|
|
4:85605139-85605139
|
WDFY3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the breast, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice, Growth abnormality |
|
|
9:15199927-15199927
|
TTC39B | A/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the breast, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice, Growth abnormality |
|
|
19:52091581-52091581
|
ZNF175 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:103910956-103910956
|
SLC9B1 | C/T | Likely LOF (splice donor variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye |
|
|
4:40440024-40440024
|
RBM47 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the breast, Abnormality of the nervous system, Growth abnormality |
|
| SF1 | CT/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system |
||
|
5:170883661-170883661
|
FGF18 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the breast, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
7:50514957-50514957
|
FIGNL1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:47889737-47889737
|
DHX30 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:29395192-29395192
|
OR11A1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
15:55931895-55931895
|
PRTG | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
10:70673195-70673195
|
DDX50 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
X:106846592-106846592
|
FRMPD3 | C/CT | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:95258770-95258770
|
ECM2 | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:90313615-90313615
|
DAPK1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:27861354-27861358
|
HIST1H2BO | CTCTA/C | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
22:19865895-19865895
|
TXNRD2 | A/C | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:150902444-150902444
|
SETDB1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
X:103294941-103294941
|
H2BFM | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:422112-422112
|
TMEM8A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:10586559-10586559
|
CLNK | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:9603110-9603110
|
WEE1 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
3:72495674-72495674
|
RYBP | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Neoplasm |
|
|
20:2560604-2560604
|
TMC2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
17:61660984-61660984
|
DCAF7 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:38565777-38565778
|
BTBD9 | CA/C | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:7107128-7107128
|
DLG4 | G/C | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of the musculature, Abnormality of the nervous system |
|
|
5:78964733-78964733
|
PAPD4 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:98550945-98550945
|
TRRAP | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:48954444-48954444
|
OR5BS1P | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
18:22057290-22057290
|
HRH4 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
17:71346840-71346840
|
SDK2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:51690030-51690030
|
RAD54L2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:38565777-38565778
|
BTBD9 | CA/C | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
14:24538364-24538364
|
LRRC16B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the musculature, Abnormality of the nervous system |
|
|
12:64784096-64784096
|
C12orf56 | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system | |
|
20:3026345-3026350
|
GNRH2 | AGCCCC/A | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of the cardiovascular system | |
|
20:3026345-3026350
|
GNRH2 | AGCCCC/A | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of the cardiovascular system, Abnormality of the respiratory system |
|
|
19:15918640-15918640
|
OR10H1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:48828114-48828114
|
LUC7L3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
4:73964004-73964004
|
ANKRD17 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:129792542-129792542
|
JADE1 | G/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| ABL1 | CAAG/C | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
||
|
2:241830948-241830948
|
C2orf54 | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of metabolism/homeostasis, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:212798638-212798638
|
FAM71A | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of metabolism/homeostasis, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
13:20577050-20577050
|
ZMYM2 | C/CT | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear |
|
|
3:124515297-124515297
|
ITGB5 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the respiratory system |
|
| ITPK1 | GTGTGT/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
3:129023627-129023627
|
HMCES | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:79747399-79747399
|
SYT1 | G/C | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:43227360-43227360
|
TTBK1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
2:100368751-100368751
|
AFF3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
9:71080008-71080008
|
PGM5 | G/A | Likely LOF (splice acceptor variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
X:114425787-114425787
|
RBMXL3 | C/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:26043875-26043875
|
HIST1H2BB | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of the endocrine system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
4:153574055-153574055
|
TMEM154 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
22:39095868-39095868
|
JOSD1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system |
|
|
10:23292328-23292328
|
ARMC3 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| BAZ1A | ATTAC/A | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | ||
|
1:220791791-220791791
|
MARK1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:169167746-169167746
|
DDX60 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:27149757-27149757
|
TM7SF3 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:179079522-179079522
|
ABL2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:65652091-65652091
|
FIBP | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:60902360-60902360
|
LAMA5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system |
|
|
5:156752582-156752582
|
CYFIP2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system |
|
| ENKUR | G/GT | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
7:134928116-134928116
|
STRA8 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:152137966-152137966
|
ZNF185 | C/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
13:77844588-77844588
|
MYCBP2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:3574410-3574410
|
HMG20B | C/T | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:56620652-56620652
|
C17orf47 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the nervous system |
|
|
16:28847422-28847422
|
ATXN2L | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:41062063-41062063
|
SPTBN4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the skeletal system, Growth abnormality |
|
|
8:99039730-99039730
|
MATN2 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the skeletal system, Growth abnormality |
|
|
5:132422529-132422529
|
HSPA4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the skeletal system, Growth abnormality |
|
|
12:8212644-8212644
|
C3AR1 | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the skeletal system, Growth abnormality |
|
|
12:7030866-7030866
|
ENO2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
| FUCA2 | GT/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
1:33583552-33583552
|
ADC | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the endocrine system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
7:6431665-6431665
|
RAC1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the endocrine system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:25297531-25297531
|
CASC1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
14:105834449-105834449
|
PACS2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:13605768-13605768
|
BOD1L1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:24544986-24544986
|
IZUMO3 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of the nervous system |
|
|
4:39448022-39448022
|
KLB | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of the nervous system |
|
|
7:138968091-138968091
|
UBN2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
18:72021271-72021271
|
C18orf63 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
15:74315592-74315592
|
PML | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
5:7709415-7709415
|
ADCY2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:4870167-4870167
|
GALNT8 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system, Growth abnormality |
|
|
X:23018946-23018946
|
DDX53 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
X:72347641-72347642
|
NAP1L6 | CG/C | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
18:77679203-77679203
|
PQLC1 | G/A | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:2186110-2186110
|
SMG6 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
10:121652423-121652423
|
SEC23IP | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
22:38240251-38240251
|
ANKRD54 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:100244260-100244260
|
ACTL6B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:61908869-61908869
|
PSMC5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
4:184367793-184367793
|
CDKN2AIP | T/G | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:480046-480046
|
SLC9A3 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:48040514-48040514
|
FBXO11 | G/GACCTATAA | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:204425156-204425156
|
PIK3C2B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:70720008-70720008
|
DDX21 | A/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
22:38824137-38824137
|
KCNJ4 | T/C | Protein Changing (initiator codon variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the ear, Abnormality of the nervous system |
|
| FAM193A | AC/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the ear, Abnormality of the nervous system |
||
|
11:62505758-62505758
|
TTC9C | A/G | Likely LOF (splice acceptor variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
9:85615352-85615352
|
RASEF | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:90605664-90605664
|
GJA10 | C/T | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of the breast, Abnormality of the musculature, Abnormality of the nervous system |
|
|
14:104570753-104570753
|
ASPG | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system |
|
|
3:11400094-11400094
|
ATG7 | C/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system |
|
|
3:25677425-25677425
|
TOP2B | A/G | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the skeletal system |
|
|
6:13365367-13365367
|
GFOD1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
3:121395745-121395745
|
GOLGB1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
20:48523040-48523040
|
SPATA2 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:123005096-123005096
|
RSRC2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:103359829-103359829
|
ZCCHC18 | C/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of the nervous system | |
|
19:14694225-14694225
|
CLEC17A | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
19:2235814-2235814
|
PLEKHJ1 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
7:142206734-142206734
|
TRBV10-2 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
2:234676910-234676910
|
UGT1A7 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
14:105613740-105613740
|
JAG2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:12958248-12958248
|
MAST1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
4:1332953-1332953
|
MAEA | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the breast, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| CDC42BPB | A/AG | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the breast, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
X:24006634-24006634
|
KLHL15 | C/A | Likely LOF (stop gained) |
De novo constitutive | Hemizygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
3:183774793-183774793
|
HTR3C | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:196626829-196626829
|
SENP5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
6:49986737-49986737
|
DEFB110 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
6:79752692-79752692
|
PHIP | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
14:51561429-51561429
|
TRIM9 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:136240085-136240085
|
STAG1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| GAK | A/AC | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
7:11675889-11675889
|
THSD7A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of metabolism/homeostasis, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
20:52198293-52198293
|
ZNF217 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
3:37163003-37163003
|
LRRFIP2 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
1:100964826-100964826
|
CDC14A | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:236729269-236729269
|
HEATR1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:57886705-57886705
|
OR9I1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:100491165-100491167
|
UHRF1BP1L | ATT/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:52131256-52131256
|
SIGLEC5 | A/AG | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:38690707-38690707
|
DNAH8 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
14:21469472-21469472
|
SLC39A2 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system |
|
|
1:202121749-202121749
|
PTPN7 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
| JMJD1C | T/TAG | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
||
|
10:127412498-127412498
|
EDRF1 | C/A | Likely LOF (stop gained) |
Paternally inherited, constitutive in father | Compound heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:127422012-127422012
|
EDRF1 | G/GA | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Compound heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:53580237-53580237
|
ZNF740 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:100047737-100047737
|
ADH4 | T/C | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:46265072-46265072
|
NCOA3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:197187292-197187292
|
HECW2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:120817713-120817716
|
EIF3A | TCTC/T | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:111936311-111936311
|
ZNF277 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
| CNOT2 | GC/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
||
|
17:27233444-27233444
|
PHF12 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:79733699-79733699
|
ZFYVE16 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:31092895-31092895
|
ZNF646 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the skeletal system |
|
|
3:133553466-133553466
|
RAB6B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the skeletal system |
|
|
2:45808941-45808941
|
SRBD1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the skeletal system |
|
|
21:16338753-16338753
|
NRIP1 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
8:146107046-146107046
|
ZNF250 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:46196550-46196550
|
SNX11 | T/A | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:67937277-67937277
|
STARD8 | T/A | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of abdomen morphology, Abnormality of the cardiovascular system, Abnormality of the endocrine system, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
1:223803831-223803831
|
CAPN8 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:48267008-48267008
|
OR4X2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
5:149633109-149633109
|
CAMK2A | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:109904255-109904255
|
TMEM232 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:160667123-160667123
|
LY75 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
15:98513107-98513107
|
ARRDC4 | T/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:28634913-28634923
|
FOSL2 | TAGCCCCGAGG/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:38395753-38395753
|
ALDH1B1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:57581083-57581083
|
LRP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
15:42107466-42107466
|
MAPKBP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:189065268-189065268
|
TRIML1 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:33138422-33138422
|
RBBP4 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:223465814-223465814
|
SUSD4 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
5:77771361-77771361
|
SCAMP1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:10794137-10794137
|
CTR9 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the skeletal system |
|
|
3:192973579-192973579
|
HRASLS | G/A | Likely LOF (splice donor variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the skeletal system |
|
|
1:156526450-156526450
|
IQGAP3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the skeletal system |
|
|
2:88407883-88407883
|
SMYD1 | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
16:68025998-68025998
|
DPEP2 | A/C | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of the eye, Abnormality of the nervous system, Growth abnormality |
|
|
9:5920441-5920441
|
KIAA2026 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Growth abnormality |
|
| SPEN | AGAAGT/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
6:158735124-158735124
|
TULP4 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
X:123197045-123197045
|
STAG2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
2:237103565-237103565
|
ASB18 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
X:70779215-70779215
|
OGT | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:47944911-47944911
|
PKD1L1 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:46999302-46999323
|
GPRIN2 | TCAGCTGCTCAGCCCTTGGCAG/T | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Neoplasm |
|
| TSNARE1 | TCTC/T | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | ||
|
19:57665821-57665822
|
DUXA | AG/A | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of the nervous system | |
|
3:121383343-121383343
|
GOLGB1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
7:155559194-155559194
|
RBM33 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
1:86939159-86939159
|
CLCA1 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:7681414-7681414
|
CAMSAP3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the voice, Growth abnormality |
|
|
17:34942611-34942611
|
GGNBP2 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the voice, Growth abnormality |
|
|
4:155158018-155158018
|
DCHS2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the voice, Growth abnormality |
|
|
11:2433381-2433381
|
TRPM5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the skeletal system, Neoplasm |
|
| GLTSCR1L | C/CA | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
||
|
8:139164403-139164403
|
FAM135B | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
X:153200953-153200953
|
RENBP | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:55212872-55212872
|
TFAP2C | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:8404289-8404289
|
MYH10 | C/T | Likely LOF (splice acceptor variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:57759784-57759784
|
CLTC | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:31506210-31506219
|
EFCAB8 | AGCAGACCCT/A | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
2:202343090-202343090
|
STRADB | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
1:1737942-1737942
|
GNB1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
X:135470034-135470034
|
GPR112 | G/T | Likely LOF (splice donor variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
16:2014480-2014510
|
RPS2 | TCCGCGGCCTCGGCCCCGGCCCCGTCCACGG/T | Protein Changing (inframe deletion) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
22:29706498-29706498
|
GAS2L1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:50926189-50926189
|
SPIB | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
8:19677166-19677166
|
INTS10 | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
10:106074180-106074180
|
ITPRIP | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:12070902-12070903
|
UPF2 | AC/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
10:92655664-92655664
|
RPP30 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the voice |
|
|
12:42792650-42792650
|
PPHLN1 | T/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the voice |
|
|
15:44105258-44105258
|
MFAP1 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
18:3814203-3814203
|
DLGAP1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
6:131602782-131602782
|
AKAP7 | T/TA | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
17:11597723-11597723
|
DNAH9 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
3:44684703-44684703
|
ZNF197 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:137727944-137727945
|
KDM3B | CT/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:138632588-138632588
|
KIAA1244 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
19:36220069-36220069
|
KMT2B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
9:103088701-103088701
|
TEX10 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
2:27865335-27865335
|
GPN1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
2:32673863-32673863
|
BIRC6 | A/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
20:31585476-31585476
|
SUN5 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| RYBP | CTT/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system |
||
|
10:32344838-32344838
|
KIF5B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:91263284-91263284
|
MAP3K7 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:126736629-126736629
|
PLXNA1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| WHSC1 | GAA/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
13:49771110-49771110
|
FNDC3A | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:175180905-175180905
|
FBXO8 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:77522942-77522942
|
PHTF2 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the skeletal system |
|
|
3:42678734-42678734
|
NKTR | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the skeletal system |
|
|
1:59147880-59147880
|
MYSM1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the skeletal system |
|
|
1:150444800-150444800
|
RPRD2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:181549809-181549809
|
CACNA1E | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
X:111195437-111195437
|
TRPC5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Hemizygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:24720063-24720063
|
MPP6 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:100623270-100623270
|
AFF3 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:123340818-123340818
|
HIP1R | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the skeletal system |
|
|
5:149607754-149607754
|
CAMK2A | C/T | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the skeletal system |
|
| SEC16A | A/AC | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
||
|
14:59821877-59821877
|
DAAM1 | T/C | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
10:61666028-61666028
|
CCDC6 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| ZFX | ATG/A | Likely LOF (frameshift variant) |
De novo constitutive | Hemizygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
16:2024199-2024199
|
TBL3 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:18777460-18777460
|
ADAMTSL1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Neoplasm |
|
|
4:17625218-17625218
|
MED28 | C/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:7960512-7960512
|
OR10A3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:10791697-10791697
|
ILF3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the nervous system, Neoplasm |
|
|
19:12186202-12186202
|
ZNF844 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:62652812-62652812
|
SLC3A2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:127642480-127642480
|
KBTBD12 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
15:69072461-69072461
|
ANP32A | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
18:9937064-9937064
|
VAPA | G/C | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the nervous system |
|
|
11:5626751-5626751
|
TRIM6 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
8:71556377-71556377
|
LACTB2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the skeletal system |
|
|
1:12252991-12252991
|
TNFRSF1B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the skeletal system |
|
|
X:14627284-14627284
|
GLRA2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the breast, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
18:203143-203143
|
USP14 | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of the breast, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:333684-333684
|
SLC6A13 | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
6:97000431-97000431
|
UFL1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
1:117509692-117509692
|
PTGFRN | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
1:226253472-226253472
|
H3F3A | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
X:153533470-153533470
|
TKTL1 | A/AG | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:26157055-26157078
|
HIST1H1E | CCCCCAAGAAGAGCGCCAAGAAGA/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:134308142-134308142
|
PRRC2B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
6:99771541-99771541
|
FAXC | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
15:68497651-68497651
|
CALML4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:29001687-29001687
|
PPP1CB | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of metabolism/homeostasis, Abnormality of the nervous system, Growth abnormality |
|
|
3:48643235-48643235
|
UQCRC1 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of metabolism/homeostasis, Abnormality of the nervous system |
|
|
2:84896626-84896626
|
DNAH6 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of metabolism/homeostasis, Abnormality of the nervous system |
|
|
1:181480603-181480603
|
CACNA1E | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system |
|
|
1:46193443-46193443
|
IPP | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system |
|
|
19:38379480-38379481
|
WDR87 | GT/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system |
|
|
X:48434643-48434644
|
RBM3 | TC/T | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:109717613-109717613
|
FOXN4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
X:10188877-10188877
|
CLCN4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:36221673-36221673
|
KMT2B | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Neoplasm |
|
|
1:1736013-1736013
|
GNB1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
19:56388513-56388513
|
NLRP4 | T/TGCCGCTTAGAGATTCTTGGGTGGGTATC | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
20:25000689-25000689
|
ACSS1 | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Growth abnormality |
|
|
12:58217764-58217764
|
CTDSP2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
15:56386847-56386848
|
RFX7 | TG/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
10:102689121-102689121
|
FAM178A | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
| SON | TGTATG/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
||
|
15:75706642-75706642
|
SIN3A | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:10574807-10574807
|
ATF7IP2 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Growth abnormality |
|
|
9:33076587-33076587
|
SMU1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
|
|
6:84417600-84417604
|
SNAP91 | CTGTA/C | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
|
|
19:48887562-48887562
|
KDELR1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the respiratory system |
|
|
12:54383045-54383045
|
HOXC10 | G/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of metabolism/homeostasis, Abnormality of prenatal development or birth, Abnormality of the respiratory system |
|
|
19:16980295-16980295
|
SIN3B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Neoplasm |
|
|
1:202411615-202411615
|
PPP1R12B | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Neoplasm |
|
|
2:48809406-48809406
|
STON1 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Neoplasm |
|
|
3:154024084-154024084
|
DHX36 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Growth abnormality |
|
|
15:101588763-101588763
|
LRRK1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
17:27963096-27963096
|
SSH2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the skeletal system, Growth abnormality |
|
|
6:38545415-38545415
|
BTBD9 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
13:33233316-33233316
|
PDS5B | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:22002002-22002002
|
ZNF43 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:30435813-30435813
|
MPPED2 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:179623772-179623772
|
TTN-AS1 | G/A | Likely LOF (splice donor variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:50492561-50492561
|
SMARCD1 | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:141093381-141093381
|
LRP1B | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the skeletal system, Growth abnormality |
|
|
15:71125118-71125118
|
LARP6 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
5:180166443-180166443
|
OR2Y1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
2:20454728-20454729
|
PUM2 | AT/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
13:99534182-99534182
|
DOCK9 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
5:160886715-160886715
|
GABRB2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
X:20062644-20062644
|
MAP7D2 | T/C | Likely LOF (splice acceptor variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:10775953-10775953
|
TEKT5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
10:131676089-131676089
|
EBF3 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
8:131949377-131949377
|
ADCY8 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Growth abnormality |
|
|
X:138698469-138698469
|
MCF2 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
2:141298596-141298596
|
LRP1B | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
1:158517262-158517262
|
OR6Y1 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:129795019-129795019
|
PRDM10 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:23408225-23408225
|
MSRB2 | T/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
14:101348137-101348137
|
RTL1 | T/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
20:52644905-52644905
|
BCAS1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the skeletal system |
|
|
11:124494858-124494858
|
TBRG1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the skeletal system |
|
|
7:98550943-98550943
|
TRRAP | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the skeletal system |
|
|
7:44281927-44281927
|
CAMK2B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the integument, Abnormality of the nervous system |
|
|
10:63173248-63173248
|
TMEM26 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:127527592-127527592
|
DHX32 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
6:26104449-26104449
|
HIST1H4C | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
1:152384619-152384619
|
CRNN | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:38023257-38023257
|
ZNF793 | G/A | Likely LOF (splice acceptor variant) |
Paternally inherited, constitutive in father | Compound heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
19:38024402-38024402
|
ZNF793 | C/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Compound heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
1:228112065-228112065
|
WNT9A | G/T | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:49200518-49200518
|
CCDC71 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the skeletal system |
|
|
14:93273276-93273276
|
GOLGA5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| PKD2L1 | ACAATATATAC/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
10:74894441-74894441
|
ECD | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:107236544-107236544
|
RIC8B | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:18972825-18972825
|
UPF1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality, Neoplasm |
|
|
12:133381500-133381500
|
GOLGA3 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system |
|
| RNFT2 | G/GAGGA | Likely LOF (frameshift variant) |
Paternally inherited, constitutive in father | Compound heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system |
||
| RNFT2 | A/AAGGG | Likely LOF (frameshift variant) |
Maternally inherited, constitutive in mother | Compound heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system |
||
|
15:41771401-41771401
|
RTF1 | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system |
|
|
10:114428034-114428034
|
VTI1A | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the musculature, Abnormality of the nervous system |
|
|
X:106418357-106418357
|
NUP62CL | G/C | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
1:207287558-207287558
|
C4BPA | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
12:133384736-133384736
|
GOLGA3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
10:99527500-99527500
|
SFRP5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
11:7982847-7982847
|
NLRP10 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the ear, Abnormality of the skeletal system |
|
|
2:197084836-197084836
|
HECW2 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
4:123171679-123171679
|
KIAA1109 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:37211474-37211476
|
ZNF567 | CTA/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:45877604-45877604
|
CRY2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:135301918-135301918
|
NUP205 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:3263936-3263936
|
PSMG4 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Growth abnormality |
|
|
8:22865113-22865113
|
RHOBTB2 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
16:837552-837553
|
RPUSD1 | CT/C | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:1756620-1756620
|
IFITM10 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of blood and blood-forming tissues, Abnormality of the nervous system |
|
|
12:10462218-10462218
|
KLRD1 | C/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
5:160071147-160071147
|
ATP10B | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
12:70345911-70345911
|
MYRFL | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the musculature, Abnormality of the nervous system, Growth abnormality |
|
|
11:77412638-77412638
|
RSF1 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the musculature, Abnormality of the nervous system, Growth abnormality |
|
|
10:131761638-131761642
|
EBF3 | TTCTC/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the musculature, Abnormality of the nervous system, Growth abnormality |
|
|
9:140137496-140137496
|
TUBB4B | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| ARHGEF2 | AC/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
12:56822100-56822100
|
TIMELESS | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the nervous system |
|
|
11:114453414-114453414
|
NXPE4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:76528939-76528939
|
CNTNAP4 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the endocrine system, Abnormality of the integument, Abnormality of the nervous system |
|
|
4:57182337-57182337
|
KIAA1211 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the endocrine system, Abnormality of the integument, Abnormality of the nervous system |
|
|
1:149885139-149885139
|
SV2A | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the endocrine system, Abnormality of the integument, Abnormality of the nervous system |
|
|
16:67579319-67579320
|
FAM65A | GC/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system |
|
|
9:19083010-19083010
|
HAUS6 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:59060146-59060159
|
TRIM28 | GAGTGGGTCTGCCT/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:48457820-48457820
|
PLXNB1 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
6:26020982-26020982
|
HIST1H3A | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
|
|
1:11900219-11900219
|
CLCN6 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
|
|
6:33746172-33746172
|
LEMD2 | A/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
|
| KIDINS220 | C/CA | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system |
||
|
10:100011447-100011447
|
LOXL4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of prenatal development or birth, Abnormality of the nervous system |
|
| GARNL3 | AG/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the nervous system, Growth abnormality |
||
|
17:60028299-60028299
|
MED13 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:96080096-96080096
|
WNK2 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:183887914-183887915
|
DVL3 | AC/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the skeletal system |
|
|
6:139164312-139164312
|
ECT2L | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Growth abnormality |
|
|
3:170099090-170099090
|
SKIL | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Growth abnormality |
|
|
20:1559029-1559029
|
SIRPB1 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice |
|
|
2:202359221-202359221
|
ALS2CR11 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
6:55684526-55684526
|
BMP5 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
3:185655648-185655648
|
TRA2B | T/C | Protein Changing (initiator codon variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
5:89925099-89925099
|
GPR98 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
13:39542604-39542604
|
STOML3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
10:96099617-96099617
|
NOC3L | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:106769876-106769876
|
FRMPD3 | C/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the musculature, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
1:205628673-205628673
|
SLC45A3 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
X:13624633-13624633
|
EGFL6 | G/A | Likely LOF (splice donor variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
10:75208454-75208454
|
PPP3CB | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
19:8464770-8464770
|
RAB11B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
17:44949890-44949890
|
WNT9B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
| PTMA | A/ACT | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system |
||
|
14:93264305-93264305
|
GOLGA5 | T/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system |
|
|
10:50105596-50105596
|
WDFY4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system |
|
|
13:45582941-45582941
|
GPALPP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
12:81751950-81751950
|
PPFIA2 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the breast, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Neoplasm |
|
|
16:31138536-31138536
|
KAT8 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:72416844-72416844
|
ARAP1 | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:1206816-1206816
|
CTBP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
9:113169644-113169644
|
SVEP1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
13:99538814-99538814
|
DOCK9 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:50189064-50189064
|
NCKAP5L | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
10:43697355-43697355
|
RASGEF1A | G/GATCTC | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
14:105916456-105916456
|
MTA1 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Abnormality of the voice |
|
|
10:33211231-33211231
|
ITGB1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:227885361-227885361
|
ZNF847P | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system |
|
|
8:75928826-75928826
|
CRISPLD1 | C/T | Likely LOF (stop gained) |
Paternally inherited, constitutive in father | Compound heterozygous | Abnormality of head or neck, Abnormality of the skeletal system, Growth abnormality |
|
|
8:75928853-75928853
|
CRISPLD1 | C/T | Likely LOF (stop gained) |
Maternally inherited, constitutive in mother | Compound heterozygous | Abnormality of head or neck, Abnormality of the skeletal system, Growth abnormality |
|
|
4:2306773-2306773
|
ZFYVE28 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of prenatal development or birth, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
10:33475258-33475258
|
NRP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:15226974-15226974
|
ILVBL | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:7810193-7810193
|
CHD3 | G/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:39282816-39282816
|
KCNK16 | G/A | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of the nervous system | |
| TRIP12 | TAA/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the nervous system |
||
|
2:203686147-203686147
|
ICA1L | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:150400037-150400037
|
FAM194A | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:46246350-46246350
|
ARID2 | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
22:46805021-46805021
|
CELSR1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
| ARGLU1 | ATCTT/A | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of prenatal development or birth, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
||
|
9:114134022-114134022
|
KIAA0368 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the nervous system |
|
|
3:126733040-126733040
|
PLXNA1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:27428308-27428308
|
SLC5A6 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:95942100-95942100
|
PROM2 | G/C | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:204198229-204198229
|
PLEKHA6 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the skeletal system, Growth abnormality |
|
|
8:145603166-145603166
|
ADCK5 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
22:50704987-50704987
|
MAPK11 | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
13:49842176-49842176
|
CDADC1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
X:36089940-36089940
|
CHDC2 | A/C | Likely LOF (splice acceptor variant) |
Maternally inherited, constitutive in mother | Hemizygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:39672464-39672464
|
KRT15 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:117560939-117560939
|
CD101 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:19665864-19665864
|
SLC24A3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:3730645-3730645
|
TJP3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:42580365-42580365
|
COX7A2L | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
18:29488748-29488748
|
TRAPPC8 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
8:125534420-125534420
|
TATDN1 | C/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
14:58874043-58874043
|
TOMM20L | G/A | Likely LOF (splice acceptor variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
3:170624837-170624837
|
EIF5A2 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the immune system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system, Growth abnormality |
|
|
16:31089108-31089108
|
ZNF646 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
21:45387860-45387860
|
AGPAT3 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
12:56561915-56561915
|
SMARCC2 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| SRRM2 | GGACTTAGA/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system, Abnormality of the respiratory system |
||
|
16:71689154-71689154
|
PHLPP2 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:168291620-168291620
|
MLLT4 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:4432070-4432070
|
CHAF1A | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:192993065-192993065
|
UCHL5 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
7:30113728-30113728
|
PLEKHA8 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Neoplasm |
|
|
1:162551100-162551100
|
UAP1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| MTA1 | TC/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the nervous system |
||
|
1:205493463-205493463
|
CDK18 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
4:48542544-48542544
|
FRYL | G/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Growth abnormality |
|
|
8:85799834-85799834
|
RALYL | C/G | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
20:30354454-30354454
|
TPX2 | A/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system |
|
|
1:6185825-6185825
|
CHD5 | C/T | Likely LOF (splice donor variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:31508178-31508178
|
DDX39B | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
1:61554017-61554017
|
NFIA | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the nervous system |
|
| APCS | G/GAATCTGT | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
19:18376510-18376510
|
KIAA1683 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
14:77327075-77327075
|
C14orf166B | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the respiratory system |
|
|
6:111680102-111680102
|
REV3L | G/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
20:31811625-31811625
|
BPIFA3 | C/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
8:39840225-39840225
|
IDO2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the nervous system, Growth abnormality, Neoplasm |
|
|
12:117593673-117593673
|
FBXO21 | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
16:56623539-56623539
|
MT3 | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
4:57173723-57173723
|
KIAA1211 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:164466816-164466816
|
FIGN | G/C | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:149485060-149485060
|
SSPO | G/A | Likely LOF (splice donor variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:149480598-149480598
|
SSPO | G/A | Likely LOF (splice acceptor variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:90259983-90259983
|
IGKV1D-8 | C/CTCCA | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:65914918-65914918
|
BPTF | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:207170927-207170927
|
ZDBF2 | G/T | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system |
|
|
12:109690876-109690876
|
ACACB | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
9:79324987-79324987
|
PRUNE2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
3:124738148-124738148
|
HEG1 | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the integument, Abnormality of the nervous system |
|
|
10:96334308-96334308
|
HELLS | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
19:5653124-5653127
|
SAFB | AGGT/A | Likely LOF (splice acceptor variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
19:10084888-10084888
|
COL5A3 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
2:21361294-21361294
|
TDRD15 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:113192097-113192097
|
CAPZA1 | T/C | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of connective tissue, Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
11:104872840-104872840
|
CASP5 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the eye, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:3005436-3005436
|
TLE2 | T/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
12:69983431-69983431
|
CCT2 | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
9:20789435-20789435
|
FOCAD | C/A | Likely LOF (stop gained) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
19:52780788-52780792
|
ZNF766 | TACTC/T | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system |
|
|
19:36393093-36393093
|
NFKBID | A/G | Likely LOF (splice donor variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system |
|
|
19:12812635-12812635
|
TNPO2 | G/A | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system |
|
|
5:140306559-140306559
|
PCDHAC1 | G/T | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the musculature, Abnormality of the nervous system |
|
|
14:23531438-23531438
|
ACIN1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
| DMXL1 | T/TC | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
11:6977626-6977626
|
ZNF215 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
17:31618770-31618780
|
ASIC2 | GGTGCACCCGC/G | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
7:64438982-64438986
|
ZNF117 | GGTCA/G | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
3:46729697-46729697
|
ALS2CL | C/A | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
7:64438982-64438986
|
ZNF117 | GGTCA/G | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of limbs, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
3:158386878-158386883
|
LXN | ATGTAG/A | Likely LOF (frameshift variant) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of blood and blood-forming tissues, Abnormality of head or neck, Abnormality of limbs, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the immune system, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
22:41368485-41368485
|
RBX1 | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
2:160019902-160019902
|
TANC1 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the eye, Abnormality of the nervous system, Abnormality of the skeletal system, Growth abnormality |
|
|
20:49204435-49204435
|
FAM65C | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of abdomen morphology, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system, Growth abnormality |
|
|
1:110302518-110302518
|
EPS8L3 | G/A | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the cardiovascular system, Abnormality of the endocrine system, Abnormality of the eye, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the respiratory system, Abnormality of the skeletal system |
|
|
7:99054258-99054258
|
CPSF4 | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| CTNND1 | TG/T | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the musculature |
||
|
13:96238382-96238382
|
DZIP1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the cardiovascular system, Abnormality of the ear, Abnormality of the genitourinary system, Abnormality of the integument, Abnormality of the musculature |
|
|
7:143080171-143080171
|
ZYX | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
6:26124663-26124663
|
HIST1H2AC | G/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
1:225152222-225152222
|
DNAH14 | C/T | Likely LOF (stop gained) |
Biparental | Homozygous | Abnormality of abdomen morphology, Abnormality of head or neck, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system |
|
|
12:120196390-120196390
|
CIT | C/T | In annotated regulatory region (splice region variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
9:127302436-127302436
|
NR6A1 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
4:107037373-107037373
|
TBCK | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the nervous system |
|
|
12:57677678-57677678
|
R3HDM2 | A/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of the breast, Abnormality of the eye, Abnormality of the immune system, Abnormality of the integument, Abnormality of the nervous system, Abnormality of the skeletal system |
|
| CHMP7 | CA/C | Likely LOF (frameshift variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
||
|
10:95082844-95082844
|
MYOF | T/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the ear, Abnormality of the integument, Abnormality of the musculature, Abnormality of the nervous system, Abnormality of the skeletal system |
|
|
19:12813732-12813732
|
TNPO2 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
1:212519270-212519270
|
PPP2R5A | C/G | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of the nervous system | |
|
5:76128818-76128818
|
F2RL1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of metabolism/homeostasis, Abnormality of the integument, Abnormality of the nervous system |
|
|
5:109181656-109181656
|
MAN2A1 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the skeletal system |
|
|
4:62800598-62800598
|
LPHN3 | C/T | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
12:29630076-29630076
|
OVCH1 | A/C | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
1:156642529-156642529
|
NES | G/A | Protein Changing (missense variant) |
De novo constitutive | Heterozygous | Abnormality of head or neck, Abnormality of limbs, Abnormality of the eye, Abnormality of the genitourinary system, Abnormality of the nervous system, Growth abnormality |
|
|
12:81762502-81762502</ |