DDD Research Variants

Variants of unknown significance in 4293 children with developmental disorders in the UK DDD study (www.ddduk.org). Variants have been identified from high quality calls from exome sequencing data (most have not been validated) and include functional de novo variants and rare loss-of-function homozygous, compound heterozygous and hemizygous variants in genes that are neither developmental disorder genes or OMIM-morbid genes in children who remain undiagnosed in the DDD study.

High-level phenotype terms are provided for each patient, and further details can be obtained by contacting DECIPHER directly (decipher@sanger.ac.uk). Diagnostic variants from the DDD study are in the standard DECIPHER Sequence Variant and Copy-Number Variant tracks linked to individual patients.

Location Gene Allele Consequence Inheritance Genotype Phenotypes Contact
17:56059245-56059246
VEZF1 AG/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:128750773-128750773
SAP130 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:78560637-78560637
GIPC2 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
3:12977945-12977945
IQSEC1 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
19:35500816-35500816
GRAMD1A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
1:46495845-46495845
MAST2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
2:28634934-28634935
FOSL2 GC/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
19:50265271-50265271
TSKS G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
16:24887052-24887052
SLC5A11 G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
10:126662892-126662892
ZRANB1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:98109538-98109538
OPALIN C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
1:89270569-89270569
PKN2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
15:64966774-64966774
ZNF609 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system
X:104463811-104463812
TEX13A CT/C Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of the nervous system
X:104463811-104463812
TEX13A CT/C Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of the nervous system
2:170489746-170489746
PPIG A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:165649827-165649827
ALDH9A1 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
12:43770459-43770459
ADAMTS20 G/GT In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
16:28884855-28884855
SH2B1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
7:44282257-44282257
CAMK2B C/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
9:140446855-140446855
MRPL41 A/AC Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
3:189681746-189681746
LEPREL1 C/T Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
17:27005584-27005584
SUPT6H C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
3:23930720-23930720
UBE2E1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:142967383-142967383
UBE2NL G/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the nervous system
17:65909197-65909197
BPTF C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
21:33044498-33044498
SCAF4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality,
Neoplasm
1:160794025-160794025
LY9 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality,
Neoplasm
6:26157043-26157043
HIST1H1E C/CG Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:105473053-105473053
POU3F3 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Neoplasm
21:32639148-32639148
TIAM1 C/CACCT Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Abnormality of the respiratory system
10:121551412-121551415
INPP5F AGAG/A Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:38142858-38142858
PSMD3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
4:90830554-90830554
MMRN1 A/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system
17:15995345-15995345
NCOR1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:129246087-129246087
BARX2 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:48183259-48183259
GLTSCR1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:55978830-55978830
OR8J2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
1:117064570-117064570
CD58 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:15306138-15306138
ASB11 G/A Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of the nervous system
19:41086756-41086756
SHKBP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
6:28543860-28543860
SCAND3 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
18:74091434-74091434
ZNF516 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
4:40438616-40438616
RBM47 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the nervous system
1:109271328-109271331
FNDC7 AATG/A Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the skeletal system
8:30643756-30643759
PPP2CB GGAA/G Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:120054210-120054210
HSD3B1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Growth abnormality
X:106466065-106466065
PIH1D3 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument
8:22675247-22675247
PEBP4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
2:218953991-218953991
RUFY4 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
16:22320792-22320792
POLR3E A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:55650813-55650814
FOXR2 AC/A Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
7:80374231-80374231
SEMA3C C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
6:138745228-138745228
NHSL1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
10:135202549-135202549
PAOX C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:2223997-2223997
TRAF7 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the musculature
10:116037780-116037780
VWA2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system,
Neoplasm
13:113728852-113728852
MCF2L T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:91083440-91083440
SPIN1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
6:10634797-10634797
GCNT6 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
11:831273-831273
EFCAB4A C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Growth abnormality
18:12449803-12449803
SPIRE1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
14:64989628-64989628
ZBTB1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:57442097-57442097
MYO1A A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:77709263-77709263
TMEM63C G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:85838904-85838904
C2orf68 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:109691337-109691338
ZNF462 AC/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:49506565-49506565
RUVBL2 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
4:125591766-125591766
ANKRD50 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:100275696-100275696
TMEM45A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
12:26377286-26377286
SSPN C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
X:140983281-140983283
MAGEC3 CCA/C Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
20:37277327-37277327
ARHGAP40 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
10:99052336-99052336
ARHGAP19 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
X:57021329-57021329
SPIN3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:27121488-27121488
DPYSL5 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:30937218-30937218
FBXL19 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:53116998-53116998
TSPYL2 T/G Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
15:65884011-65884011
VWA9 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system
9:128113102-128113102
GAPVD1 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system
6:34508815-34508815
SPDEF G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system
1:40702501-40702501
RLF G/GAAAA Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system
16:88947694-88947694
CBFA2T3 C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the nervous system
11:6623422-6623422
RRP8 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
12:59274606-59274606
LRIG3 A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:49448180-49448180
DHDH A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
19:19030151-19030151
COPE G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the skeletal system,
Growth abnormality
2:135308217-135308217
TMEM163 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the skeletal system,
Growth abnormality
19:48006665-48006665
NAPA G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:132481618-132481618
PRRX2 T/TCGAG Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:137848452-137848452
ETF1 C/T Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:227381633-227381633
CDC42BPA G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:125831632-125831632
ALDH1L1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:118264282-118264282
DTWD2 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:57581487-57581487
CTSZ C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the skeletal system
2:161137833-161137833
RBMS1 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the skeletal system
2:27121488-27121488
DPYSL5 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:122522801-122522801
TSN G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
4:25253982-25253982
PI4K2B A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
21:34922300-34922300
SON C/CT Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
20:52558069-52558069
BCAS1 A/C In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:135801165-135801165
PPP2R3A A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the breast,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:1584630-1584630
MBD3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument
13:30351370-30351370
UBL3 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument
2:171248925-171248925
MYO3B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the musculature,
Abnormality of the nervous system
4:74014541-74014541
ANKRD17 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system
21:40569125-40569125
BRWD1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
16:2223990-2223990
TRAF7 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the respiratory system,
Abnormality of the skeletal system
12:117595691-117595691
FBXO21 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the nervous system
11:10827534-10827534
EIF4G2 A/AGT Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the nervous system
13:26923295-26923295
CDK8 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:27107209-27107209
HIST1H4I G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument
2:33817146-33817146
FAM98A C/A Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument
10:3167371-3167371
PFKP C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:69158644-69158644
SLC35E3 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:130799416-130799416
NEK11 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system
19:58059287-58059287
ZNF550 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:105834449-105834449
PACS2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:5686526-5686526
TRIM5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
17:56060217-56060217
VEZF1 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:115109265-115109265
CADM1 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the skeletal system
12:80222146-80222146
PPP1R12A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:38893319-38893320
GALM AG/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the nervous system
11:3687683-3687683
CHRNA10 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
19:42133262-42133262
CEACAM4 C/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
17:48734399-48734399
ABCC3 C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:152487933-152487933
CRCT1 C/CCGCCCCGGCGCCCACCCCGG Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:139903856-139903856
ABCA2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
19:11456031-11456031
TMEM205 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
17:7806037-7806037
CHD3 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
11:10774217-10774217
CTR9 A/C Likely LOF
(splice acceptor variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
16:11857495-11857495
ZC3H7A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
11:119206698-119206698
RNF26 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
10:530768-530768
DIP2C C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the respiratory system
12:6669354-6669354
NOP2 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the respiratory system
3:66502061-66502064
LRIG1 TAAC/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the skeletal system,
Growth abnormality
6:159672555-159672555
FNDC1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the skeletal system,
Growth abnormality
2:219140313-219140313
TMBIM1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
2:29016735-29016735
PPP1CB G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Growth abnormality
19:21301008-21301008
ZNF714 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
19:1036542-1036542
CNN2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:34240646-34240646
RBM12 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
11:95516390-95516390
FAM76B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
4:134073108-134073108
PCDH10 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
11:5699591-5699591
TRIM5 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
15:65456511-65456511
CLPX C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:47374777-47374777
KLHL18 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:79576321-79576321
DLG5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the endocrine system,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:76503456-76503456
DNAH17 G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:46190703-46190703
SNX11 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:49336010-49336010
HSD17B14 C/G Likely LOF
(splice acceptor variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:1158062-1158062
MUC5AC C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
22:20940056-20940056
MED15 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
11:46407071-46407071
CHRM4 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
2:135180458-135180458
MGAT5 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:14027118-14027118
GEMIN8 T/TTCTGTATGACATCTAAGCTCTGTA Likely LOF
(stop gained)
De novo constitutive Hemizygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
2:242039038-242039038
MTERFD2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:53115010-53115010
TSPYL2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
18:43572096-43572096
PSTPIP2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:169299608-169299609
DDX60L TG/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:117289569-117289569
RNFT2 A/AAGGG Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Growth abnormality
1:110766447-110766447
KCNC4 T/TC Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Growth abnormality
2:43451899-43451925
ZFP36L2 GGCCCCCGGCGCCAGCAGGTCCTCGGC/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Growth abnormality
22:29957172-29957172
NIPSNAP1 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
3:192053223-192053223
FGF12 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
6:44102451-44102451
TMEM63B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
7:45009399-45009399
MYO1G C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the immune system,
Abnormality of the integument
5:139909363-139909363
ANKHD1-EIF4EBP3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology
19:1527982-1527982
PLK5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the nervous system
15:38808490-38808490
RASGRP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the nervous system
7:94903256-94903256
PPP1R9A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the nervous system
1:173839494-173839494
ZBTB37 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the nervous system
14:64153202-64153202
SGPP1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
1:33745934-33745934
ZNF362 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
1:36359409-36359409
AGO1 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the nervous system
X:71427544-71427544
ERCC6L A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
2:135988379-135988379
ZRANB3 G/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
2:206921225-206921227
INO80D GTT/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:58115759-58115760
ZNF530 GT/G Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
9:37777620-37777620
TRMT10B C/A Likely LOF
(stop gained)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
4:36126591-36126591
ARAP2 T/A Likely LOF
(splice acceptor variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
22:23465544-23465544
GNAZ A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
6:43173912-43173912
CUL9 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:158621832-158621832
RNF145 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:1464855-1464855
BRSK2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
1:33234379-33234396
KIAA1522 GGATTCATGGGCAGGGGA/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
20:32377326-32377326
ZNF341 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice,
Growth abnormality
2:114501320-114501321
SLC35F5 GT/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice,
Growth abnormality
1:248224776-248224776
OR2L3 C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice,
Growth abnormality
7:57528844-57528845
ZNF716 CA/C Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:89956076-89956076
CHORDC1 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
3:173525475-173525475
NLGN1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
16:15730009-15730009
KIAA0430 G/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
9:37746434-37746434
FRMPD1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear
21:46067225-46067225
KRTAP10-11 C/CG Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Neoplasm
14:24885633-24885633
NYNRIN G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:109546416-109546416
RPL34 A/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of metabolism/homeostasis,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
15:37376088-37376088
MEIS2 T/C Likely LOF
(splice acceptor variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:14043651-14043651
PODNL1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
10:126631792-126631792
ZRANB1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
11:66053228-66053228
YIF1A C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the skeletal system
12:50492587-50492587
SMARCD1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
11:55761693-55761693
OR5F1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
11:123886946-123886946
OR10G4 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system
8:110394735-110394735
PKHD1L1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system
16:66783106-66783106
DYNC1LI2 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system
17:80544011-80544011
FOXK2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
3:42242333-42242337
TRAK1 CAGTA/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
16:58555172-58555172
CNOT1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:990886-990886
DMRT3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:131300452-131300452
CPNE4 A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:232321342-232321342
NCL G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
11:103908677-103908677
DDI1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
19:6456534-6456534
SLC25A23 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the nervous system
7:105909701-105909701
NAMPT T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:85397173-85397173
CCDC89 T/A Protein Changing
(initiator codon variant)
De novo constitutive Heterozygous Abnormality of the integument,
Abnormality of the nervous system
17:74084968-74084968
EXOC7 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the respiratory system,
Abnormality of the skeletal system
5:114620509-114620509
CCDC112 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the respiratory system,
Abnormality of the skeletal system
1:152130281-152130281
RPTN A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the respiratory system,
Abnormality of the skeletal system
19:56172517-56172517
U2AF2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
15:68119340-68119340
SKOR1 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
4:17528485-17528485
CLRN2 A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
7:45009309-45009309
MYO1G G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the skeletal system
19:14000692-14000692
C19orf57 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of blood and blood-forming tissues,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
7:48312799-48312799
ABCA13 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:129173111-129173111
BCORL1 G/T Likely LOF
(splice acceptor variant)
De novo constitutive Hemizygous Abnormality of abdomen morphology,
Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:407794-407794
CHL1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the breast,
Abnormality of the ear,
Abnormality of the nervous system
2:74328470-74328470
TET3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the breast,
Abnormality of the ear,
Abnormality of the nervous system
12:4721720-4721720
DYRK4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the breast,
Abnormality of the ear,
Abnormality of the nervous system
19:52090836-52090836
ZNF175 C/T Likely LOF
(stop gained)
Biparental Homozygous Abnormality of the breast,
Abnormality of the ear,
Abnormality of the nervous system
17:73805947-73805947
UNK C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system
22:43623383-43623383
SCUBE1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
6:127796845-127796845
SOGA3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:156812858-156812858
INSRR G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
17:64738805-64738805
PRKCA T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
5:64976535-64976535
SGTB T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the musculature,
Abnormality of the skeletal system
1:201816449-201816449
IPO9 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the musculature,
Abnormality of the skeletal system
1:10132189-10132189
UBE4B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
X:15768282-15768282
CA5B C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
10:103868839-103868840
LDB1 TG/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:91931692-91931692
SMEK1 A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:143082644-143082645
HIVEP2 TC/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:80007662-80007662
RFNG A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:54635689-54635689
CBX5 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
17:57647918-57647918
DHX40 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
5:137427116-137427116
WNT8A A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
20:60893618-60893618
LAMA5 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
17:42290219-42290219
UBTF C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
9:88938530-88938530
ZCCHC6 A/C Protein Changing
(initiator codon variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
19:47424630-47424630
ARHGAP35 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:175046825-175046825
TNN C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
7:137607344-137607346
CREB3L2 AAC/A Likely LOF
(frameshift variant)
Paternally inherited, constitutive in father Compound heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
7:137569632-137569632
CREB3L2 C/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Compound heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
15:41192208-41192208
VPS18 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:57325806-57325806
PEG3 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:52467445-52467445
C12orf44 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:78676546-78676546
ROBO1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:96117248-96117250
CCDC82 CCA/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
3:135870774-135870774
MSL2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system
3:78666808-78666808
ROBO1 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system
2:220250352-220250352
DNPEP C/A Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:64967030-64967030
JMJD1C C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
18:32825642-32825648
ZNF397 AGGTCCT/A Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of the nervous system,
Growth abnormality
19:2243509-2243509
SF3A2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the endocrine system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
15:41819766-41819766
RPAP1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
X:54836213-54836213
MAGED2 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument
12:111786041-111786041
CUX2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
17:57754422-57754422
CLTC C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:24580172-24580172
RBBP6 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:22390766-22390766
GPR125 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Growth abnormality
20:61512815-61512815
DIDO1 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Growth abnormality
2:27478190-27478190
SLC30A3 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Growth abnormality
16:58633145-58633145
CNOT1 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
14:100820157-100820157
WARS C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:160761761-160761761
GABRB2 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
19:2936616-2936616
ZNF77 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
13:103510661-103510661
BIVM-ERCC5 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
8:3611464-3611464
CSMD1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:5021677-5021678
BHLHE40 CA/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:60663539-60663539
TLK2 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:2410013-2410013
PLCH2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
11:56380662-56380662
OR5M1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:5152980-5152980
OR52A5 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
6:101075504-101075504
ASCC3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the breast,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice,
Growth abnormality
4:85605139-85605139
WDFY3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the breast,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice,
Growth abnormality
9:15199927-15199927
TTC39B A/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the breast,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice,
Growth abnormality
19:52091581-52091581
ZNF175 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:103910956-103910956
SLC9B1 C/T Likely LOF
(splice donor variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye
4:40440024-40440024
RBM47 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the breast,
Abnormality of the nervous system,
Growth abnormality
11:64537008-64537009
SF1 CT/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system
5:170883661-170883661
FGF18 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
7:50514957-50514957
FIGNL1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:47889737-47889737
DHX30 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:29395192-29395192
OR11A1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
15:55931895-55931895
PRTG T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
10:70673195-70673195
DDX50 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
X:106846592-106846592
FRMPD3 C/CT Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:95258770-95258770
ECM2 G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:90313615-90313615
DAPK1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:27861354-27861358
HIST1H2BO CTCTA/C Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
22:19865895-19865895
TXNRD2 A/C Likely LOF
(stop gained)
Biparental Homozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:150902444-150902444
SETDB1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
X:103294941-103294941
H2BFM C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:422112-422112
TMEM8A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:10586559-10586559
CLNK C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:9603110-9603110
WEE1 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
3:72495674-72495674
RYBP C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Neoplasm
20:2560604-2560604
TMC2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
17:61660984-61660984
DCAF7 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:38565777-38565778
BTBD9 CA/C Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:7107128-7107128
DLG4 G/C Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of the musculature,
Abnormality of the nervous system
5:78964733-78964733
PAPD4 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:98550945-98550945
TRRAP G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:48954444-48954444
OR5BS1P C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
18:22057290-22057290
HRH4 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
17:71346840-71346840
SDK2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:51690030-51690030
RAD54L2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:38565777-38565778
BTBD9 CA/C Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:24538364-24538364
LRRC16B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the musculature,
Abnormality of the nervous system
12:64784096-64784096
C12orf56 G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system
20:3026345-3026350
GNRH2 AGCCCC/A Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of the cardiovascular system
20:3026345-3026350
GNRH2 AGCCCC/A Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of the cardiovascular system,
Abnormality of the respiratory system
19:15918640-15918640
OR10H1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:48828114-48828114
LUC7L3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
4:73964004-73964004
ANKRD17 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:129792542-129792542
JADE1 G/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:133759489-133759492
ABL1 CAAG/C Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
2:241830948-241830948
C2orf54 C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of metabolism/homeostasis,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:212798638-212798638
FAM71A G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of metabolism/homeostasis,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
13:20577050-20577050
ZMYM2 C/CT Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear
3:124515297-124515297
ITGB5 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the respiratory system
14:93532675-93532680
ITPK1 GTGTGT/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:129023627-129023627
HMCES A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Abnormality of the skeletal system
12:79747399-79747399
SYT1 G/C In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Abnormality of the skeletal system
6:43227360-43227360
TTBK1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
2:100368751-100368751
AFF3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
9:71080008-71080008
PGM5 G/A Likely LOF
(splice acceptor variant)
De novo constitutive Heterozygous Abnormality of the nervous system
X:114425787-114425787
RBMXL3 C/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:26043875-26043875
HIST1H2BB G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of the endocrine system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
4:153574055-153574055
TMEM154 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system
22:39095868-39095868
JOSD1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system
10:23292328-23292328
ARMC3 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:35224024-35224028
BAZ1A ATTAC/A Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of the nervous system
1:220791791-220791791
MARK1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:169167746-169167746
DDX60 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
12:27149757-27149757
TM7SF3 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:179079522-179079522
ABL2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:65652091-65652091
FIBP G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:60902360-60902360
LAMA5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system
5:156752582-156752582
CYFIP2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system
10:25279500-25279500
ENKUR G/GT Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:134928116-134928116
STRA8 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:152137966-152137966
ZNF185 C/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
13:77844588-77844588
MYCBP2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:3574410-3574410
HMG20B C/T Likely LOF
(stop gained)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:56620652-56620652
C17orf47 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the nervous system
16:28847422-28847422
ATXN2L C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:41062063-41062063
SPTBN4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the skeletal system,
Growth abnormality
8:99039730-99039730
MATN2 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the skeletal system,
Growth abnormality
5:132422529-132422529
HSPA4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the skeletal system,
Growth abnormality
12:8212644-8212644
C3AR1 C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the skeletal system,
Growth abnormality
12:7030866-7030866
ENO2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
6:143828391-143828392
FUCA2 GT/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:33583552-33583552
ADC C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the endocrine system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
7:6431665-6431665
RAC1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the endocrine system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:25297531-25297531
CASC1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:105834449-105834449
PACS2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:13605768-13605768
BOD1L1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:24544986-24544986
IZUMO3 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of the nervous system
4:39448022-39448022
KLB G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of the nervous system
7:138968091-138968091
UBN2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
18:72021271-72021271
C18orf63 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
15:74315592-74315592
PML C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
5:7709415-7709415
ADCY2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:4870167-4870167
GALNT8 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Growth abnormality
X:23018946-23018946
DDX53 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
X:72347641-72347642
NAP1L6 CG/C Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
18:77679203-77679203
PQLC1 G/A Likely LOF
(stop gained)
Biparental Homozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:2186110-2186110
SMG6 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
10:121652423-121652423
SEC23IP C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
22:38240251-38240251
ANKRD54 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:100244260-100244260
ACTL6B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:61908869-61908869
PSMC5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
4:184367793-184367793
CDKN2AIP T/G Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:480046-480046
SLC9A3 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:48040514-48040514
FBXO11 G/GACCTATAA Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:204425156-204425156
PIK3C2B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:70720008-70720008
DDX21 A/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the nervous system
22:38824137-38824137
KCNJ4 T/C Protein Changing
(initiator codon variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the nervous system
4:2695554-2695555
FAM193A AC/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the nervous system
11:62505758-62505758
TTC9C A/G Likely LOF
(splice acceptor variant)
De novo constitutive Heterozygous Abnormality of the nervous system
9:85615352-85615352
RASEF G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:90605664-90605664
GJA10 C/T Likely LOF
(stop gained)
Biparental Homozygous Abnormality of the breast,
Abnormality of the musculature,
Abnormality of the nervous system
14:104570753-104570753
ASPG G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system
3:11400094-11400094
ATG7 C/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system
3:25677425-25677425
TOP2B A/G Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the skeletal system
6:13365367-13365367
GFOD1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
3:121395745-121395745
GOLGB1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
20:48523040-48523040
SPATA2 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:123005096-123005096
RSRC2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:103359829-103359829
ZCCHC18 C/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of the nervous system
19:14694225-14694225
CLEC17A A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
19:2235814-2235814
PLEKHJ1 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
7:142206734-142206734
TRBV10-2 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
2:234676910-234676910
UGT1A7 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
14:105613740-105613740
JAG2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:12958248-12958248
MAST1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system
4:1332953-1332953
MAEA T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the breast,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:103447182-103447182
CDC42BPB A/AG Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the breast,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:24006634-24006634
KLHL15 C/A Likely LOF
(stop gained)
De novo constitutive Hemizygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
3:183774793-183774793
HTR3C C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:196626829-196626829
SENP5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
6:49986737-49986737
DEFB110 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
6:79752692-79752692
PHIP A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
14:51561429-51561429
TRIM9 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:136240085-136240085
STAG1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:845555-845555
GAK A/AC Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:11675889-11675889
THSD7A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of metabolism/homeostasis,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
20:52198293-52198293
ZNF217 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
3:37163003-37163003
LRRFIP2 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
1:100964826-100964826
CDC14A C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:236729269-236729269
HEATR1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:57886705-57886705
OR9I1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the skeletal system,
Growth abnormality
12:100491165-100491167
UHRF1BP1L ATT/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the skeletal system,
Growth abnormality
19:52131256-52131256
SIGLEC5 A/AG Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:38690707-38690707
DNAH8 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
14:21469472-21469472
SLC39A2 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system
1:202121749-202121749
PTPN7 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
10:64944393-64944393
JMJD1C T/TAG Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
10:127412498-127412498
EDRF1 C/A Likely LOF
(stop gained)
Paternally inherited, constitutive in father Compound heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:127422012-127422012
EDRF1 G/GA Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Compound heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:53580237-53580237
ZNF740 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:100047737-100047737
ADH4 T/C In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:46265072-46265072
NCOA3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:197187292-197187292
HECW2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:120817713-120817716
EIF3A TCTC/T Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:111936311-111936311
ZNF277 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:70732581-70732582
CNOT2 GC/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
17:27233444-27233444
PHF12 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:79733699-79733699
ZFYVE16 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:31092895-31092895
ZNF646 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the skeletal system
3:133553466-133553466
RAB6B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the skeletal system
2:45808941-45808941
SRBD1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the skeletal system
21:16338753-16338753
NRIP1 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
8:146107046-146107046
ZNF250 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:46196550-46196550
SNX11 T/A Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:67937277-67937277
STARD8 T/A Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of abdomen morphology,
Abnormality of the cardiovascular system,
Abnormality of the endocrine system,
Abnormality of the genitourinary system,
Abnormality of the nervous system
1:223803831-223803831
CAPN8 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:48267008-48267008
OR4X2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
5:149633109-149633109
CAMK2A G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:109904255-109904255
TMEM232 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:160667123-160667123
LY75 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
15:98513107-98513107
ARRDC4 T/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:28634913-28634923
FOSL2 TAGCCCCGAGG/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:38395753-38395753
ALDH1B1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:57581083-57581083
LRP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
15:42107466-42107466
MAPKBP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:189065268-189065268
TRIML1 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:33138422-33138422
RBBP4 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:223465814-223465814
SUSD4 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
5:77771361-77771361
SCAMP1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:10794137-10794137
CTR9 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the skeletal system
3:192973579-192973579
HRASLS G/A Likely LOF
(splice donor variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the skeletal system
1:156526450-156526450
IQGAP3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the skeletal system
2:88407883-88407883
SMYD1 C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
16:68025998-68025998
DPEP2 A/C Likely LOF
(stop gained)
Biparental Homozygous Abnormality of the eye,
Abnormality of the nervous system,
Growth abnormality
9:5920441-5920441
KIAA2026 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Growth abnormality
1:16259692-16259697
SPEN AGAAGT/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:158735124-158735124
TULP4 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
X:123197045-123197045
STAG2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
2:237103565-237103565
ASB18 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
X:70779215-70779215
OGT T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:47944911-47944911
PKD1L1 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:46999302-46999323
GPRIN2 TCAGCTGCTCAGCCCTTGGCAG/T Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Neoplasm
8:143365782-143365785
TSNARE1 TCTC/T Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of the nervous system
19:57665821-57665822
DUXA AG/A Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of the nervous system
3:121383343-121383343
GOLGB1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
7:155559194-155559194
RBM33 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
1:86939159-86939159
CLCA1 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:7681414-7681414
CAMSAP3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the voice,
Growth abnormality
17:34942611-34942611
GGNBP2 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the voice,
Growth abnormality
4:155158018-155158018
DCHS2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the voice,
Growth abnormality
11:2433381-2433381
TRPM5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the skeletal system,
Neoplasm
6:42796427-42796427
GLTSCR1L C/CA Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
8:139164403-139164403
FAM135B G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
X:153200953-153200953
RENBP C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:55212872-55212872
TFAP2C A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:8404289-8404289
MYH10 C/T Likely LOF
(splice acceptor variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:57759784-57759784
CLTC C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:31506210-31506219
EFCAB8 AGCAGACCCT/A Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system
2:202343090-202343090
STRADB A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system
1:1737942-1737942
GNB1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system
X:135470034-135470034
GPR112 G/T Likely LOF
(splice donor variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
16:2014480-2014510
RPS2 TCCGCGGCCTCGGCCCCGGCCCCGTCCACGG/T Protein Changing
(inframe deletion)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
22:29706498-29706498
GAS2L1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:50926189-50926189
SPIB C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
8:19677166-19677166
INTS10 A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
10:106074180-106074180
ITPRIP T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:12070902-12070903
UPF2 AC/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
10:92655664-92655664
RPP30 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the voice
12:42792650-42792650
PPHLN1 T/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the voice
15:44105258-44105258
MFAP1 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
18:3814203-3814203
DLGAP1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
6:131602782-131602782
AKAP7 T/TA Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
17:11597723-11597723
DNAH9 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
3:44684703-44684703
ZNF197 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:137727944-137727945
KDM3B CT/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:138632588-138632588
KIAA1244 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
19:36220069-36220069
KMT2B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
9:103088701-103088701
TEX10 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
2:27865335-27865335
GPN1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
2:32673863-32673863
BIRC6 A/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the nervous system
20:31585476-31585476
SUN5 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:72428469-72428471
RYBP CTT/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system
10:32344838-32344838
KIF5B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:91263284-91263284
MAP3K7 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:126736629-126736629
PLXNA1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:1918602-1918604
WHSC1 GAA/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
13:49771110-49771110
FNDC3A C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:175180905-175180905
FBXO8 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:77522942-77522942
PHTF2 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the skeletal system
3:42678734-42678734
NKTR A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the skeletal system
1:59147880-59147880
MYSM1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the skeletal system
1:150444800-150444800
RPRD2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:181549809-181549809
CACNA1E T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
X:111195437-111195437
TRPC5 C/T Protein Changing
(missense variant)
De novo constitutive Hemizygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:24720063-24720063
MPP6 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:100623270-100623270
AFF3 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:123340818-123340818
HIP1R C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the skeletal system
5:149607754-149607754
CAMK2A C/T Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the skeletal system
9:139369732-139369732
SEC16A A/AC Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
14:59821877-59821877
DAAM1 T/C In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
10:61666028-61666028
CCDC6 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:24197660-24197662
ZFX ATG/A Likely LOF
(frameshift variant)
De novo constitutive Hemizygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:2024199-2024199
TBL3 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:18777460-18777460
ADAMTSL1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Neoplasm
4:17625218-17625218
MED28 C/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:7960512-7960512
OR10A3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:10791697-10791697
ILF3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the nervous system,
Neoplasm
19:12186202-12186202
ZNF844 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:62652812-62652812
SLC3A2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:127642480-127642480
KBTBD12 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
15:69072461-69072461
ANP32A G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
18:9937064-9937064
VAPA G/C Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the nervous system
11:5626751-5626751
TRIM6 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
8:71556377-71556377
LACTB2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the skeletal system
1:12252991-12252991
TNFRSF1B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the skeletal system
X:14627284-14627284
GLRA2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the breast,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
18:203143-203143
USP14 C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of the breast,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:333684-333684
SLC6A13 G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
6:97000431-97000431
UFL1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
1:117509692-117509692
PTGFRN A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
1:226253472-226253472
H3F3A G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
X:153533470-153533470
TKTL1 A/AG Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:26157055-26157078
HIST1H1E CCCCCAAGAAGAGCGCCAAGAAGA/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:134308142-134308142
PRRC2B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
6:99771541-99771541
FAXC G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
15:68497651-68497651
CALML4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:29001687-29001687
PPP1CB G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of metabolism/homeostasis,
Abnormality of the nervous system,
Growth abnormality
3:48643235-48643235
UQCRC1 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of metabolism/homeostasis,
Abnormality of the nervous system
2:84896626-84896626
DNAH6 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of metabolism/homeostasis,
Abnormality of the nervous system
1:181480603-181480603
CACNA1E C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system
1:46193443-46193443
IPP C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system
19:38379480-38379481
WDR87 GT/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system
X:48434643-48434644
RBM3 TC/T Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:109717613-109717613
FOXN4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
X:10188877-10188877
CLCN4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:36221673-36221673
KMT2B T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Neoplasm
1:1736013-1736013
GNB1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
19:56388513-56388513
NLRP4 T/TGCCGCTTAGAGATTCTTGGGTGGGTATC Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
20:25000689-25000689
ACSS1 C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Growth abnormality
12:58217764-58217764
CTDSP2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
15:56386847-56386848
RFX7 TG/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the nervous system
10:102689121-102689121
FAM178A G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
21:34925384-34925389
SON TGTATG/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
15:75706642-75706642
SIN3A G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:10574807-10574807
ATF7IP2 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Growth abnormality
9:33076587-33076587
SMU1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
6:84417600-84417604
SNAP91 CTGTA/C Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
19:48887562-48887562
KDELR1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the respiratory system
12:54383045-54383045
HOXC10 G/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of metabolism/homeostasis,
Abnormality of prenatal development or birth,
Abnormality of the respiratory system
19:16980295-16980295
SIN3B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Neoplasm
1:202411615-202411615
PPP1R12B C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Neoplasm
2:48809406-48809406
STON1 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Neoplasm
3:154024084-154024084
DHX36 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Growth abnormality
15:101588763-101588763
LRRK1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
17:27963096-27963096
SSH2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the skeletal system,
Growth abnormality
6:38545415-38545415
BTBD9 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
13:33233316-33233316
PDS5B A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:22002002-22002002
ZNF43 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:30435813-30435813
MPPED2 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:179623772-179623772
TTN-AS1 G/A Likely LOF
(splice donor variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:50492561-50492561
SMARCD1 G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:141093381-141093381
LRP1B G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the skeletal system,
Growth abnormality
15:71125118-71125118
LARP6 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
5:180166443-180166443
OR2Y1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
2:20454728-20454729
PUM2 AT/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
13:99534182-99534182
DOCK9 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
5:160886715-160886715
GABRB2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
X:20062644-20062644
MAP7D2 T/C Likely LOF
(splice acceptor variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:10775953-10775953
TEKT5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
10:131676089-131676089
EBF3 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
8:131949377-131949377
ADCY8 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Growth abnormality
X:138698469-138698469
MCF2 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
2:141298596-141298596
LRP1B C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the respiratory system,
Abnormality of the skeletal system
1:158517262-158517262
OR6Y1 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:129795019-129795019
PRDM10 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:23408225-23408225
MSRB2 T/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
14:101348137-101348137
RTL1 T/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
20:52644905-52644905
BCAS1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the skeletal system
11:124494858-124494858
TBRG1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the skeletal system
7:98550943-98550943
TRRAP T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the skeletal system
7:44281927-44281927
CAMK2B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the integument,
Abnormality of the nervous system
10:63173248-63173248
TMEM26 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:127527592-127527592
DHX32 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
6:26104449-26104449
HIST1H4C A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
1:152384619-152384619
CRNN C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:38023257-38023257
ZNF793 G/A Likely LOF
(splice acceptor variant)
Paternally inherited, constitutive in father Compound heterozygous Abnormality of head or neck,
Abnormality of the nervous system
19:38024402-38024402
ZNF793 C/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Compound heterozygous Abnormality of head or neck,
Abnormality of the nervous system
1:228112065-228112065
WNT9A G/T Likely LOF
(stop gained)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:49200518-49200518
CCDC71 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the skeletal system
14:93273276-93273276
GOLGA5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:102088991-102089001
PKD2L1 ACAATATATAC/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:74894441-74894441
ECD G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:107236544-107236544
RIC8B T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:18972825-18972825
UPF1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality,
Neoplasm
12:133381500-133381500
GOLGA3 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system
12:117289581-117289581
RNFT2 G/GAGGA Likely LOF
(frameshift variant)
Paternally inherited, constitutive in father Compound heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system
12:117289569-117289569
RNFT2 A/AAGGG Likely LOF
(frameshift variant)
Maternally inherited, constitutive in mother Compound heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system
15:41771401-41771401
RTF1 G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system
10:114428034-114428034
VTI1A G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the musculature,
Abnormality of the nervous system
X:106418357-106418357
NUP62CL G/C Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the respiratory system
1:207287558-207287558
C4BPA G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the respiratory system
12:133384736-133384736
GOLGA3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
10:99527500-99527500
SFRP5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
11:7982847-7982847
NLRP10 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the ear,
Abnormality of the skeletal system
2:197084836-197084836
HECW2 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
4:123171679-123171679
KIAA1109 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:37211474-37211476
ZNF567 CTA/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:45877604-45877604
CRY2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:135301918-135301918
NUP205 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:3263936-3263936
PSMG4 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Growth abnormality
8:22865113-22865113
RHOBTB2 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
16:837552-837553
RPUSD1 CT/C In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:1756620-1756620
IFITM10 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of blood and blood-forming tissues,
Abnormality of the nervous system
12:10462218-10462218
KLRD1 C/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
5:160071147-160071147
ATP10B G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
12:70345911-70345911
MYRFL T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the musculature,
Abnormality of the nervous system,
Growth abnormality
11:77412638-77412638
RSF1 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the musculature,
Abnormality of the nervous system,
Growth abnormality
10:131761638-131761642
EBF3 TTCTC/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the musculature,
Abnormality of the nervous system,
Growth abnormality
9:140137496-140137496
TUBB4B C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:155922522-155922523
ARHGEF2 AC/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:56822100-56822100
TIMELESS G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the nervous system
11:114453414-114453414
NXPE4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:76528939-76528939
CNTNAP4 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the endocrine system,
Abnormality of the integument,
Abnormality of the nervous system
4:57182337-57182337
KIAA1211 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the endocrine system,
Abnormality of the integument,
Abnormality of the nervous system
1:149885139-149885139
SV2A T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the endocrine system,
Abnormality of the integument,
Abnormality of the nervous system
16:67579319-67579320
FAM65A GC/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system
9:19083010-19083010
HAUS6 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:59060146-59060159
TRIM28 GAGTGGGTCTGCCT/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:48457820-48457820
PLXNB1 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
6:26020982-26020982
HIST1H3A G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
1:11900219-11900219
CLCN6 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
6:33746172-33746172
LEMD2 A/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
2:8871645-8871645
KIDINS220 C/CA Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system
10:100011447-100011447
LOXL4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of prenatal development or birth,
Abnormality of the nervous system
9:130145735-130145736
GARNL3 AG/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the nervous system,
Growth abnormality
17:60028299-60028299
MED13 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:96080096-96080096
WNK2 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:183887914-183887915
DVL3 AC/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the skeletal system
6:139164312-139164312
ECT2L G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Growth abnormality
3:170099090-170099090
SKIL G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Growth abnormality
20:1559029-1559029
SIRPB1 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice
2:202359221-202359221
ALS2CR11 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
6:55684526-55684526
BMP5 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
3:185655648-185655648
TRA2B T/C Protein Changing
(initiator codon variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
5:89925099-89925099
GPR98 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
13:39542604-39542604
STOML3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
10:96099617-96099617
NOC3L C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:106769876-106769876
FRMPD3 C/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the respiratory system,
Abnormality of the skeletal system
1:205628673-205628673
SLC45A3 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
X:13624633-13624633
EGFL6 G/A Likely LOF
(splice donor variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:75208454-75208454
PPP3CB G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
19:8464770-8464770
RAB11B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
17:44949890-44949890
WNT9B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
2:232576107-232576107
PTMA A/ACT Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system
14:93264305-93264305
GOLGA5 T/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system
10:50105596-50105596
WDFY4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system
13:45582941-45582941
GPALPP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
12:81751950-81751950
PPFIA2 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the breast,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Neoplasm
16:31138536-31138536
KAT8 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:72416844-72416844
ARAP1 C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:1206816-1206816
CTBP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
9:113169644-113169644
SVEP1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
13:99538814-99538814
DOCK9 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:50189064-50189064
NCKAP5L G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
10:43697355-43697355
RASGEF1A G/GATCTC Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
14:105916456-105916456
MTA1 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Abnormality of the voice
10:33211231-33211231
ITGB1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:227885361-227885361
ZNF847P G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system
8:75928826-75928826
CRISPLD1 C/T Likely LOF
(stop gained)
Paternally inherited, constitutive in father Compound heterozygous Abnormality of head or neck,
Abnormality of the skeletal system,
Growth abnormality
8:75928853-75928853
CRISPLD1 C/T Likely LOF
(stop gained)
Maternally inherited, constitutive in mother Compound heterozygous Abnormality of head or neck,
Abnormality of the skeletal system,
Growth abnormality
4:2306773-2306773
ZFYVE28 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of prenatal development or birth,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
10:33475258-33475258
NRP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:15226974-15226974
ILVBL C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:7810193-7810193
CHD3 G/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:39282816-39282816
KCNK16 G/A Likely LOF
(stop gained)
Biparental Homozygous Abnormality of the nervous system
2:230668866-230668868
TRIP12 TAA/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the nervous system
2:203686147-203686147
ICA1L T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:150400037-150400037
FAM194A T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:46246350-46246350
ARID2 C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
22:46805021-46805021
CELSR1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
13:107196468-107196472
ARGLU1 ATCTT/A Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of prenatal development or birth,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
9:114134022-114134022
KIAA0368 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the nervous system
3:126733040-126733040
PLXNA1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:27428308-27428308
SLC5A6 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:95942100-95942100
PROM2 G/C In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:204198229-204198229
PLEKHA6 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the skeletal system,
Growth abnormality
8:145603166-145603166
ADCK5 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
22:50704987-50704987
MAPK11 G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
13:49842176-49842176
CDADC1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
X:36089940-36089940
CHDC2 A/C Likely LOF
(splice acceptor variant)
Maternally inherited, constitutive in mother Hemizygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:39672464-39672464
KRT15 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:117560939-117560939
CD101 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:19665864-19665864
SLC24A3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:3730645-3730645
TJP3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:42580365-42580365
COX7A2L T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
18:29488748-29488748
TRAPPC8 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
8:125534420-125534420
TATDN1 C/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
14:58874043-58874043
TOMM20L G/A Likely LOF
(splice acceptor variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
3:170624837-170624837
EIF5A2 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Growth abnormality
16:31089108-31089108
ZNF646 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
21:45387860-45387860
AGPAT3 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
12:56561915-56561915
SMARCC2 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:2814865-2814873
SRRM2 GGACTTAGA/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the nervous system,
Abnormality of the respiratory system
16:71689154-71689154
PHLPP2 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:168291620-168291620
MLLT4 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:4432070-4432070
CHAF1A G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:192993065-192993065
UCHL5 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
7:30113728-30113728
PLEKHA8 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Neoplasm
1:162551100-162551100
UAP1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:105905032-105905033
MTA1 TC/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the nervous system
1:205493463-205493463
CDK18 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
4:48542544-48542544
FRYL G/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Growth abnormality
8:85799834-85799834
RALYL C/G In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
20:30354454-30354454
TPX2 A/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system
1:6185825-6185825
CHD5 C/T Likely LOF
(splice donor variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:31508178-31508178
DDX39B G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
1:61554017-61554017
NFIA T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the nervous system
1:159557923-159557923
APCS G/GAATCTGT Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:18376510-18376510
KIAA1683 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
14:77327075-77327075
C14orf166B G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the respiratory system
6:111680102-111680102
REV3L G/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
20:31811625-31811625
BPIFA3 C/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
8:39840225-39840225
IDO2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the nervous system,
Growth abnormality,
Neoplasm
12:117593673-117593673
FBXO21 T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
16:56623539-56623539
MT3 C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
4:57173723-57173723
KIAA1211 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:164466816-164466816
FIGN G/C Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:149485060-149485060
SSPO G/A Likely LOF
(splice donor variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:149480598-149480598
SSPO G/A Likely LOF
(splice acceptor variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:90259983-90259983
IGKV1D-8 C/CTCCA Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:65914918-65914918
BPTF G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:207170927-207170927
ZDBF2 G/T Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system
12:109690876-109690876
ACACB G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
9:79324987-79324987
PRUNE2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
3:124738148-124738148
HEG1 A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the integument,
Abnormality of the nervous system
10:96334308-96334308
HELLS C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
19:5653124-5653127
SAFB AGGT/A Likely LOF
(splice acceptor variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
19:10084888-10084888
COL5A3 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
2:21361294-21361294
TDRD15 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:113192097-113192097
CAPZA1 T/C In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of connective tissue,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:104872840-104872840
CASP5 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the eye,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:3005436-3005436
TLE2 T/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
12:69983431-69983431
CCT2 C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
9:20789435-20789435
FOCAD C/A Likely LOF
(stop gained)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
19:52780788-52780792
ZNF766 TACTC/T Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system
19:36393093-36393093
NFKBID A/G Likely LOF
(splice donor variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system
19:12812635-12812635
TNPO2 G/A Likely LOF
(stop gained)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system
5:140306559-140306559
PCDHAC1 G/T Likely LOF
(stop gained)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the musculature,
Abnormality of the nervous system
14:23531438-23531438
ACIN1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
5:118502301-118502301
DMXL1 T/TC In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:6977626-6977626
ZNF215 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system
17:31618770-31618780
ASIC2 GGTGCACCCGC/G Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
7:64438982-64438986
ZNF117 GGTCA/G Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
3:46729697-46729697
ALS2CL C/A Likely LOF
(stop gained)
Biparental Homozygous Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
7:64438982-64438986
ZNF117 GGTCA/G Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system
3:158386878-158386883
LXN ATGTAG/A Likely LOF
(frameshift variant)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of blood and blood-forming tissues,
Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the immune system,
Abnormality of the nervous system,
Abnormality of the skeletal system
22:41368485-41368485
RBX1 G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
2:160019902-160019902
TANC1 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the eye,
Abnormality of the nervous system,
Abnormality of the skeletal system,
Growth abnormality
20:49204435-49204435
FAM65C C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of abdomen morphology,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system,
Growth abnormality
1:110302518-110302518
EPS8L3 G/A In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the cardiovascular system,
Abnormality of the endocrine system,
Abnormality of the eye,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the respiratory system,
Abnormality of the skeletal system
7:99054258-99054258
CPSF4 G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the nervous system,
Abnormality of the skeletal system
11:57571265-57571266
CTNND1 TG/T Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the musculature
13:96238382-96238382
DZIP1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the cardiovascular system,
Abnormality of the ear,
Abnormality of the genitourinary system,
Abnormality of the integument,
Abnormality of the musculature
7:143080171-143080171
ZYX C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
6:26124663-26124663
HIST1H2AC G/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system,
Abnormality of the skeletal system
1:225152222-225152222
DNAH14 C/T Likely LOF
(stop gained)
Biparental Homozygous Abnormality of abdomen morphology,
Abnormality of head or neck,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system
12:120196390-120196390
CIT C/T In annotated regulatory region
(splice region variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
9:127302436-127302436
NR6A1 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
4:107037373-107037373
TBCK G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the nervous system
12:57677678-57677678
R3HDM2 A/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of the breast,
Abnormality of the eye,
Abnormality of the immune system,
Abnormality of the integument,
Abnormality of the nervous system,
Abnormality of the skeletal system
8:23118075-23118076
CHMP7 CA/C Likely LOF
(frameshift variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
10:95082844-95082844
MYOF T/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the ear,
Abnormality of the integument,
Abnormality of the musculature,
Abnormality of the nervous system,
Abnormality of the skeletal system
19:12813732-12813732
TNPO2 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
1:212519270-212519270
PPP2R5A C/G Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of the nervous system
5:76128818-76128818
F2RL1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of metabolism/homeostasis,
Abnormality of the integument,
Abnormality of the nervous system
5:109181656-109181656
MAN2A1 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the skeletal system
4:62800598-62800598
LPHN3 C/T Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
12:29630076-29630076
OVCH1 A/C Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
1:156642529-156642529
NES G/A Protein Changing
(missense variant)
De novo constitutive Heterozygous Abnormality of head or neck,
Abnormality of limbs,
Abnormality of the eye,
Abnormality of the genitourinary system,
Abnormality of the nervous system,
Growth abnormality
12:81762502-81762502</